Description
Pre-made micro RNA expression lentivirus for human hsa-miR-4284 (MIMAT0016915):
The human microRNA precursors and its native context sequences (upstream and downstream flanking genomic sequences) was cloned into a GenTarget’s miRNA expression lentivector: pLenti-TetCMV(GFP-3UTR/miRNA)-Rsv(Puro). The miRNA cloned at 3’UTR or GFP marker under an optional inducible CMV promoter. It can be used for constitutive miR expression or used as inducible miR expression when the TetR repressor is present. The GFP signal provides a real-time monitor for the miRNA expression levels and the lentivirus transduction efficiency.
The cloned miRNA express precursor sequence is listed below. Note: the Red-highlighted region is the miR Stem-loop sequence:
GTCTGGTCTCAAACTCTTGGGCTCAAGTGATCTTCCCACCTTGGCTTCCCAAAGTGCTGGGAGTATAGG
TGTGAGCCGCCACCATGCCCGGCCTGAGCATGTTCTGTGAGGGGCTCACATCACCCCATCAAAGTGGGG
ACTCATGGGGAGAGGGGGTAGTTAGGAGCTTTGATAGAGGCGGCTCAGAGGGGCCTCCTCTCTTTAAGA
TATCGTACCACCTCCCCAGCAGCTAAAATAAATCCTCGTTCCCACTCCCCACCGAGTGCCTGGGGCTGT
CACCA
It guarantees to generate the matured miRNA sequence as follows:
gggcucacaucaccccau
See Produce Manual for details.
Amounts:
1) 200 ul of ready-to-use specific miRNA expression lentivirus in DMEM-medium containing 60 ug polybrene (10x).
2) 200 ul of ready-to-use Negative-control miRNA expression lentivirus in DMEM-medium containing 60 ug polybrene (10x). (Note: The miR-Control does not transcribe any miRNA sequences, but has the same backbone with GFP marker).
Virus titer: 1×107 IFU/ml,
Shipping: overnight shipment in dry-ice package. (Note: This product is pre-made in stock, ready to ship via overnight dry-ice package)