hsa-let-7f-5p (MIMAT0000067) miRNA expression lentivirus

$800.00

SKU: miR#11 Category:

Description

Pre-made micro RNA exrepssion lentivirus for human hsa-let-7f-5p (MIMAT0000067):

The  human microRNA precursors and its native context sequences (upstream and downstream flanking genomic sequences) was cloned into a GenTarget’s miRNA expression lentivector: pLenti-TetCMV(GFP-3UTR/miRNA)-Rsv(Puro). The miRNA cloned at 3’UTR or GFP marker under an optional inducible CMV promoter.  It can be used for constitutive miR expression or used as inducible miR expression when the TetR repressor is prescent. The GFP signal provides a real-time monitor for the miRNA expression levels and the lentivirus transduction efficiency.

The cloned miRNA express precursor sequence is listed below. Note: the Red-highlighted region is the miR Stem-loop sequence: 

TAAATGTATTTTTTTATTTTGATTTATGCTGATAATTTTATGTTGAAATTTTCTTTCGAAAG 

AGATTGTACTTTCCATTCCAGAAGAAAACATTGCTCTATCAGAGTGAGGTAGTAGATTG 

TATAGTTGTGGGGTAGTGATTTTACCCTGTTCAGGAGATAACTATACAATCTATTGCCTT 

CCCTGAGGAGTAGACTTGCTGCATTATTTTCTTTTTATTTAGATGATATTAAAACTCAGA 

AGAATTAATTTTGACATTTTGTATTTACAGTTTATCAGTTAATTTT

It guarantees to generate the matured miRNA sequence as follows:

UGAGGUAGUAGAUUGUAUAGUU

See Produce manual for details.

Amounts: 

1) 200 ul of ready-to-use specific miRNA expression lentivirus in DMEM-medium containing 60 ug polybrene (10x).

2) 200 ul of ready-to-use Negative-control miRNA expression lentivirus in DMEM-medium containing 60 ug polybrene (10x). (Note: The miR-Control  does not transcribe any miRNA sequences, but has the same backbone with GFP marker).

Virus titer: 1×107 IFU/ml,

Shipping: overnight shipment in dry-ice package. (Note: This product is pre-made in stock, ready to ship via overnight dry-ice package)

CAT#: miR#11