Description
The SEAP (Secreted Embryonic Alkaline Phosphatase) is commonly used as a powerful reporter gene whose signal can be detected via chemiluminescent reporter assay based on dioxetane CSPD (chloro-5-substituted adamantyl-1,2-dioxetane phosphate), and provides a convenient and highly sensitive method for the quantitation of transcriptional activity. SEAP secreted into cell culture supernatant and therefore offers many advantages over intracellular reporters, like luciferase. It allows to determine reporter activity without disturbing the cells, does not require the preparation of cell lysates and can be used for kinetic studies.
This premade Lentivirus express SEAP reporter under a minimal promoter that embedded with optimized tandem repeats of Androgen Response Element (AR) sequence motif (5′- TGGAGGAACATATTGTATTTATT). It contains the Red Fluorescent Protein (RFP) marker under the constitutive RSV promoter. See Product Manual for details (.pdf).
If desired, you can also use the Pathway control lentivirus to establish the No-response control profile to your pathway stimulus. The correct pathway control virus is: CAT#: Path-Ctr22
This is concentrated higher titer lentivirus, provided in PBS solution, best used for hard-to-transduced cell types or for serum-free cell culture.
Amount: 200ul/per vial, at 1 x 108 IFU/ml in PBS.
Cat#: LVP1243-PBS