FOXO Pathway

1. About FOXO Pathway:

The FOXO (Forkhead box O) signaling pathway is crucial for regulating various cellular processes, including metabolism, cell cycle control, apoptosis, and stress resistance. FOXO protein family bind to specific DNA sequences (FOXO-responsive elements) in the promoters of their target genes to increase transcription. FOXO proteins can act as tumor suppressors by inducing cell cycle arrest and apoptosis. Loss of FOXO function can contribute to tumorigenesis. [Ref1].

2. Lentivirus Detects Foxo Pathway:

GenTarget developed a set of reporting lentivirus to monitor FOXO (PI3K/AKT) signaling pathway activity. Those reporting lentivirus has a luminescent report (Luciferase) or a fluorescent report (GFP), under a minimal CMV promoter (mCMV) that embedded with optimized tandem repeats of FOXO transcriptional response element (TRE), sequence motif (5′- GTAAACAATTGTTTACGTAAATAA 3′) [Ref 2]. (Please be noted, this specific TRE motif may vary in different biological contexts).

Upon this pathway activated, FOXO is dephosphorylated, translocates to the nucleus and binds to FOXO binding motif in the report’s promoter region, leading to increased expression of the reporter protein (luciferase or GFP). The amount of light produced (luminescence) or GFP fluorescent signal intensity, is proportional to the activity of the FOXO pathway.

3. Structure of the Reporting Lentivirus:

The pathway specific reporting Lentivirus use either firefly-luciferase or GFP signal changes to detect the pathway’s activity.   Those reporting lentivirus also contains a constitutively expressed Puromycin antibiotic selection marker, or a GFP fluorescent selection marker, which makes it easier to select the stably transduced signal reporting cells, via Puromycin killing or GFP sorting respectively. See lentivector core scheme below.

The premade, ready-to-use reporter lentivirus provides a much easier tool to monitor the activity of the signaling pathways in virtually any mammalian cell type. It also allows to generate your own reporting cell line in your desired cell type for study or screening of pathway specific gene-knockdown, over-expression, or chemical / drug/protein treatment in the cell based assay.

Click the Product Manual (pdf) for all available products for this pathway reporter.