Description
Pre-made lentivirus express GFP reporter under a minimal promoter that embedded with optimized tandem repeats of Androgen Response Element (AR) sequence motif (5′- TGGAGGAACATATTGTATTTATT). This lentivirus also express the RFP fluorescent marker under the constitutive RSV promoter. See Product Manual for details (.pdf).
If desired, you can also use the Pathway control lentivirus to establish the No-response control profile to your pathway stimulus. The correct pathway control virus is: CAT#: Path-Ctr13
Amount: 200ul/per vial, at 1 x 107 IFU/ml in DMEM medium with 10% FBS.
Cat#: LVP912-R
