AR-RLuc (GFP) lentivirus in PBS

$650.00

SKU: LVP915-G-PBS Categories: , ,

Description

Pre-made lentivirus express Renilla luciferase (RLuc) reporter under a minimal promoter that embedded with optimized tandem repeats of Androgen Response Element (ARE) sequence motif (5′- TGGAGGAACATATTGTATTTATT). This lentivirus  also contain the GFP fluorescent marker under RSV promoter.  See Product Manual for details (.pdf).

If desired, you can also use the Pathway control lentivirus to establish the No-response control profile to your pathway stimulus. The correct pathway control virus is: CAT#: Path-Ctr18

This is concentrated lentivirus provided in PBS solution, used for hard-to-transduced cell types or for serum-free cell culture.

Amount:  200ul/per vial, at 1 x 108 IFU/ml in PBS. 

Cat#: LVP915-G-PBS